Material and MethodsSpecimen collection and S. aureus isolationIn a cross-sectional study, microbiological wound swabs were obtained from 95 patients with clinical signs and symptoms of burn wound infection in Burn Intensive care Unit (BICU), Besat Hospital of Hamadan, west of, Iran, between March to August 2017. A sterile swab was used for sampling of all burn patients. The swabs were obtained by the attending physicians and collected from deep regions of the burns before any washing. Identification of S. aureus was performed by standard microbiological methods included Gram staining, growth on Mannitol salt agar (MSA)(Merck, Germany), Catalase, DNase and coagulase test (20). The S.

aureus isolates were confirmed by PCR for the presence of the nuc gene (3).Antimicrobial susceptibility Testing The antimicrobial susceptibility using the following disc (Mast Co, England):  Cefoxitin (FOX 30µg), Gentamicin (GM 10 µg), Vancomycin (VA 30ug), Trimethoprim/Sulfamethoxazole (TS 25 µg), Clindamycin ( CD 2 µg) , quinoprestin/dalfoprestin (SYN  15 µg) , linezolid (LZD,  30 µg) , Ciprofloxacin (CF 5 µg),  and Imipenem (IMI 10 µg), was performed by the modified Kirby Bauer Disc diffusion method and interpreted according to Clinical Laboratory Standards (CLSI) guidelines (21). The S. aureus ATCC 25923 was included as control strain.Identification of methicillin resistant staphylococcus aureusMinimum inhibitory concentration (MIC) assays were performed by the micro broth dilution method in 96-well plates (Costar®, Corning, NY, USA), in accordance with recommendations from the CLSI (36). All S.

Best services for writing your paper according to Trustpilot

Premium Partner
From $18.00 per page
4,8 / 5
4,80
Writers Experience
4,80
Delivery
4,90
Support
4,70
Price
Recommended Service
From $13.90 per page
4,6 / 5
4,70
Writers Experience
4,70
Delivery
4,60
Support
4,60
Price
From $20.00 per page
4,5 / 5
4,80
Writers Experience
4,50
Delivery
4,40
Support
4,10
Price
* All Partners were chosen among 50+ writing services by our Customer Satisfaction Team

aureus isolates for which the MIC of Cefoxitin was ?8 ?g/ml were classified as MRSA. Methicillin resistance was identified by the presence of the mecA gene by PCR as explained previously (3). In briefly, DNA was prepared using a genomic DNA purification kit (Gene Mark, Taiwan) according to the manufacturer’s recommendations.  S.aureus  isolated  was  tested  for  the  presence of the 310 base pair  PCR  product  of  mecA  gene,  using  the  following primers:  forward (5?- GTAGAAATGACTGAACGTCCGATAA-3?) and reverse (5?- CCAATTCCACATTGTTTCGGTCTAA -3?). S. aureus ATCC 25923 was included as a positive control. Biofilm production assayS.

aureus biofilm formation was determined using the microtiter plate assay flat-bottom 96-well microtiter plates, as described previously (22). Briefly, S. aureus strains were individually grown overnight in Trypticase Soy Broth (TSB) media at 37 °C and diluted 1:10 in TSB (Merck, Germany) containing 1% glucose. 200 µL of the cell suspension per well added in 96-well microtiter plates and incubated for 24 h at 37 °C.

The wells were washed three times with 200 ml of sterile phosphate buffered saline (PBS, pH 7.4), dried at room temperature and finally stained with 1% crystal violet for 15 min. S. aureus ATCC 25923 and S.

epidermidis ATCC 12228 were used as positive and negative controls, respectively. The absorbance of the adherent biofilm was measured at 570 nm in a microplate reader. The results were divided into the four following categories according to their optical densities as (1) strong biofilm producer (0.825 < OD620); (2) medium biofilm producer (0.55 ? OD620 ? 0.825); (3) weak biofilm producer (0.

275?  OD620 < 0.55); and (4) non-biofilm (OD620 ? 0.275) (22).

Detection of biofilm formation related genes intercellular adhesion gene cluster (ica)(ica A, ica B, ica C, ica D, ica R)The simplex and multiplex PCR was conducted to determine the frequency of biofilm encoding genes in 25 S. aureus isolates. The primer sets for detection of biofilm genes were previously described by Sahab Atshan et al.

, as shown in Table 1 (24). The reaction mixture of PCR was 25 ?L in total volume containing 12.5 ?L of master mix, 0.5 ?L of each forward and reverse primers, 2 ?L of genomic DNA, and 9.5?L of distilled water. The PCR performed with an initial denaturation at 95°C for 5 min and followed for 40 cycles of denaturation at 95°C for 2 min, annealing at 60°C for 20 second and elongation at 72°C for 20 second. The final elongation was at 72°C for 5 min. The PCR performed for detection ica R according to study by Dan Yu et al.

(25). The amplified products were subjected to 2% agarose gel electrophoresis. The standard strain S.

aureus ATCC 25923 was included as a positive control for the PCR assays. For the negative control, sterile water was added rather of DNA.Detection of exfoliative toxin A-B genes (eta, etb)PCR was performed with a final volume of 20 ml according to the Master Mixes of components.  Each reaction contained 12  ml of Master Mix, 1 ml of each primer (Table 1), 2 ml of DNA as template, 4 ml of RNase-free water. The amplification conditions were 94 °c for 5 min followed by 35 cycles of amplification (denaturation at 94 °C for 1 min, annealing at 55°C for 1 min, and an extension at 72 °C for 1 min), and a final extension at 72 °C for 6 min.Statistical Analysis The frequencies of  the biofilm and exfoliative toxin A-B genes and antibiotic sensitivity and resistance patterns among the MRSA (mecA+) and MSSA (mecA?) S. aureus strains were analyzed using Chi-squared tests.

P values of ?0.05 indicated statistical significance.